DNA Analysis proves evolution
Printed From: IslamiCity.org
Category: General
Forum Name: Science & Technology
Forum Description: It is devoted for Science & Technology
URL: https://www.islamicity.org/forum/forum_posts.asp?TID=33189
Printed Date: 31 October 2024 at 6:33pm
Software Version: Web Wiz Forums 12.03 - http://www.webwizforums.com
Topic: DNA Analysis proves evolution
Posted By: Ron Webb
Subject: DNA Analysis proves evolution
Date Posted: 05 March 2015 at 8:52am
|
DNA analysis is routinely used in paternity lawsuits to prove beyond any reasonable doubt that a man is or is not the father of a child. It has proven its reliability over and over again, to the point where nobody questions it. In exactly the same way, DNA analysis can prove that we are closely related to other family members, and can even give us a fairly accurate measure of the genetic distance, i.e. how many generations ago we shared the same ancestors. We compare DNA samples and count the number of random differences, which correlates closely with genetic distance. DNA analysis is equally useful in identifying clans/tribes, ethnic groups, races, etc. The technology is extremely sophisticated, but the principle is very simple and intuitive, and the results correlate well with independent estimates of population divergence. So why would you not accept the same incontrovertible evidence that we share ancestry with other species? We share about 98% of our DNA with chimpanzees, corresponding to a genetic distance of about 10 million years. We share about 75% of our DNA with mice, 60% with fruit flies, and even about 25% with plants. Each of these percentages corresponds with a genetic distance, showing common ancestry up to a billion years ago or more. DNA analysis can tell us how closely we are related to any other living organism, whether immediate family members or vastly different species. It's nice that we also have the fossil record to confirm it, but we don't really need it -- any more than you need your dead grandfather's bones to prove that you are related to your cousins. All we need is the DNA evidence. That is proof beyond any reasonable doubt. ------------- Addeenul �Aql � Religion is intellect. |
Replies:
Posted By: Abu Loren
Date Posted: 05 March 2015 at 9:48am
|
Rubbish. What a plonker you are Ron Webb.
On the contrary DNA proves that we all originate from one pair because if you could imagine a pyramid structure then Adam and Eve (peace be upon them both) will be at the top and the resulting generations flowing down, adding extra genetical material hence the difference in the DNA. With regard to other animals that is simply saying that we are all mammals and that we have all been created from similar materials. The three percent difference in chimpanzees tells us that groups of animals can be very similar but miles apart in actual blood relations. Keep reading your science books and making stoopid threads. ------------- La Ilaha IllAllah |
Posted By: airmano
Date Posted: 05 March 2015 at 10:22am
|
@Abu Loren
Usually I don't react on your posts because I find them offensive and highly uneducated (your last one is no exception to this rule). It's a bit like teaching Boltzmann Statistics to a http://www.newscientist.com/blogs/shortsharpscience/2011/08/beyond-room-101-the-hyperaggre.html - Hyperagressive rat. Facts aside (nobody seems to care about them anyway): In your last post you seem to recognize that genetic changes can (and do) happen over time. Correct ? Airmano |
Posted By: Ron Webb
Date Posted: 05 March 2015 at 5:16pm
Stay classy, Abu! 
You can imagine anything you want, but then you have to back it up with evidence.
Hmmm, I would have put it the other way around. Just looking at the animals themselves (i.e., their morphology), I would have expected much more than three percent (I said two, but I won't quibble) difference in DNA. You really think three percent is "miles apart"?
Will do, thanks! 
------------- Addeenul �Aql � Religion is intellect. |
Abu Loren wrote:Posted By: Tim the plumber
Date Posted: 06 March 2015 at 12:58am
If your thinking that the similarity of human DNA implies that we are all descended from Adam and Eve, which is almost right ish, then the same reasoning also equally says that we are all descended from the same older primate. And the same much older original mammal. |
Posted By: Abu Loren
Date Posted: 06 March 2015 at 2:20am
I don't read your posts normally as they are complete shiite. You have nothing to offer this site. ------------- La Ilaha IllAllah |
Posted By: Quranexplorer
Date Posted: 06 March 2015 at 4:23am
By definition a theory is a set of ideas (assumptions) intended to explain something and at least to make the theory look plausible, it should be repeatedly tested by experiments and should be useful to make predictions about natural phenomena. Unfortunately, Darwin�s theory fails to do any of these and so as such the whole �evolution theory� just remains some assumptions and imaginations only. Darwin had got the imagination, what is lacking is the evidence to prove that it is 100% right. Trying to support assumptions and imaginations with more assumptions does not turn them to facts. |
Posted By: airmano
Date Posted: 06 March 2015 at 4:33am
Abu:
Another log from Allah for your personal hellfire (+ ultrafast regrowing skin) and: Sure, as a self-declared Sunni you don't like Shiites - Or is that just another spelling error ? Airmano |
Posted By: Emettman
Date Posted: 06 March 2015 at 6:20am
Did you come up with this or were you taught it? Either way it demonstrates the massive lack of doubt and critical analysis present in so many Islamic arguments. The proposition would not survive for ten seconds on any forum focussed on genetic biology. It only survives in Islamic circles because such rarely look anywhere else, and and almost never apply doubt and scepticism at any sort of healthy level on anything reputedly coming from an Islamic source. One is caught between wanting to laugh and wanting to cry at such naive trust. Chris. |
Posted By: Emettman
Date Posted: 07 March 2015 at 12:28am
Ah well, once a person has said that one need not pay any attention to anything else they have to say. Not quite on 100% evidence, but on the very marked balance of probability. What is lacking is the evidence? Someone hasn't been looking. 100% right? Someone has markedly mistaken the scientific method. Chris. |
Posted By: airmano
Date Posted: 07 March 2015 at 4:21am
QE:
Darwinism or the Theory of Evolution (TE) explains: a) Why we have an appendix b) Why Bonobos have a Genome that is almost to 98% identical to ours c) Why women can have more than two nipples d) How (new) diseases develop e) How animals/we adapt to environmental changes g) Why peacocks have beautiful feathers h) Why our eye is so badly engineered i) The origin of species k) Why our metabolism can break down alcohol (just to get it forbidden 10 Mio. years later again) l) Why leaf wing butterflies (Zaretis itys) exist m) Why moth wings (can) have long tails n)...... In science a theory is valid until another theory comes along which can not only explain as much as the former theory could, but even more (so far unexplained) observations, possibly/and/or needing less assumptions. In a philosophical sense a theory is never absolutely true, in this sense you are correct by saying "what is lacking is the evidence to prove that it is 100% right" (Epigenetics may for example lead to some minor adjustments of TE). Nevertheless, TE is almost certainly much closer to the truth than the Islamic "explanation(s)". You say TE is rubbish. On the basis of what I just wrote you can only (reasonably) say so if you have something better to offer. Could you try to lay out your (better ?) theory (explaining the above given facts for example) or is it just a lot of froth as usual ? Airmano |
Posted By: Quranexplorer
Date Posted: 09 March 2015 at 12:23pm
First of all let's get a few basics clear: 1. Theory of evolution is just a theory and a rather poor member of the "theory" family because it is neither observed nor does it have any experimental evidence. 2. Theory of evolution can never be proved. So the title of this thread itself is erroneous and misleading. Now coming to the "belief" part, I totally respect one's choice to believe in what he likes, but there are many fundamental flaws in the theory itself before one can jump to comparisons. It will be a good idea to ponder some of the fundamental failures of the theory of evolution including the following unanswered questions among many: 1. Why ET have no clue on the origin of life? Just left that to pure luck/chance? 2. Apart from the fact that evolution has never been observed, why there is not even a single complete chain of fossils that show the gradual change of one species to another? 3. The intelligent design, especially many of the fine human faculties � all that just happened out of pure chance? |
Posted By: Quranexplorer
Date Posted: 09 March 2015 at 12:36pm
The whole evolution theory itself is non-provable as it can�t be repeated or observed as it is taking place � then to say that you consider it as true based on very marked balance of probability is actually a faith-based belief. As I have made clear, I have no problems with one�s beliefs, but there is a problem when you try to present such faith based beliefs as an absolute fact. |
Posted By: airmano
Date Posted: 09 March 2015 at 12:47pm
|
QE,
it seems you're missing some basic knowledge:
It's like saying: "All cars are badly designed because they can't fly".
BTW: The http://en.wikipedia.org/wiki/Evolution_of_cetaceans - chain for the evolution of whales is pretty much completely documented.
Evolution does not happen out of pure chance, there is a well known underlying principle: The survival of the fittest. Airmano |
Posted By: Ron Webb
Date Posted: 09 March 2015 at 1:48pm
Don't you guys ever get tired of saying it's "just a theory", as if that means something? You already know the response, right? -- The theory of gravity is also "just" a theory. So what?
DNA analysis is experimental evidence. Did you read the opening post?
Scientists are very reluctant to use the word "proved", which is why the theory of gravity is also still "just a theory". But no serious scientist doubts either theory.
Because we have no significant evidence regarding the origin of life. When we don't know, we say we don't know. We don't just make stuff up (unlike some people).
Because the fossil record is necessarily incomplete; and because every time we fill in a gap, you guys just say that creates two more gaps. But as I said, we don't need the fossil record to prove common ancestry, any more than we need your grandfather's bones to prove that you are related to your cousins. All we need is DNA evidence.
No, of course not. It happened by natural selection. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Emettman
Date Posted: 09 March 2015 at 5:26pm
|
. "Theory of evolution is just a theory "
Anyone who says that has a basic lack of grasp of the word "theory" in its scientific usage. The theory of gravity is equally then "just a theory" The germ theory of disease is "just a theory" "Apart from the fact that evolution has never been observed, " Someone is very out of date. And the proposition of "Intelligent design" is more than refuted by examples, easily found, of "unintelligent design": to be expected in the *ongoing* process of natural selection, but horrible evidence of a poor designer if a conscious designer is being invoked. Impacted wisdom teeth anyone? And as for the location of the prostate gland... The basic grounds for fighting against evolution are "It can't be right as it runs counter to my theological beliefs." No wonder many want science "limited" and declare that it has nothing to say in the area of religion and faith... because the trouble is, it does. Not by intent or conspiracy, but because it is aiming at discovering better understandings of the universe and at discarding poorer ones. Seven days a literal creation of the heavens and Earth? Not unless God is a liar or designer of stage-sets, creating a universe with all the marks of an apparent age of billions of years. "We're going to need some extinct and eroded volcanoes: they'll look positively ancient." |
Posted By: Quranexplorer
Date Posted: 11 March 2015 at 11:24am
While theory of gravity has some observational and experimental evidence to its credit, evolution has nothing in these aspects: At least you can observe an apple always falling down to the earth, but you never observe a chimpanzee becoming a human. Newton�s law of gravitation gives an approximation of gravity for most situations, TE has no such laws to get support from. Gravity at least has Galileo�s experiments, but TE again has none.
Where is the experimental evidence? There is only a speculation that 2% variation in DNA between humans and chimpanzees suggests a possibility of evolution. Experimental evidence will be when you try to mutate a chimpanzee to bridge this 2% gap and then succeed to turn it to a man. On the other hand I would say if humans with 99.99% same DNA can be so different with so many races, a 200 times difference between humans and chimpanzees means an unbridgeable gap between 2 species.
As I mentioned earlier, theory of gravity looks more plausible with some observational and experimental evidence. But ET lacks both and there are serious rebuttals to the theory of evolution( http://www.goodreads.com/book/show/15753615-evolution-impossible - Evolution Impossible , http://www.discovery.org/id/books/ - Intelligent Design )
ET stands as one classic example for made up stuff. Normally an observation comes first, and then a theory to explain that with some experimental evidence. In the case of ET, the theory came first and then more and more theories to make the original theory look like a theory � no observation, no experimental evidence!
What others say should not affect your case if you have a 100% perfect case. However small the DNA gap maybe, it proves nothing unless you have at least one experimental evidence to show that this gap shall be bridged to bring about a species change or at least one observational evidence showing the gradual change of one species to another.
Humans show many behavioral and cognitive traits and abilities that offer no apparent survival advantage (e.g. music, art, religion, ability to ponder the nature of the universe) (From: http://www.evolutionnews.org/2012/07/what_are_the_to_1062011.html) |
Posted By: Tim the plumber
Date Posted: 12 March 2015 at 3:15am
Yes it does. Loads. At least you can observe an apple always falling down to the earth, but you never observe a chimpanzee becoming a human. The theory of evolution says that chimpanzees are not human and never will be. We have a common ancestor, that's all. Newton�s law of gravitation gives an approximation of gravity for most situations, TE has no such laws to get support from. Yes it does. The science of infectious disease control is heavily based on evolutionary theory. Ebola has been/is being defeated by this science. Gravity at least has Galileo�s experiments, but TE again has none. I am not aware of Galileo experimenting with gravity. TE has a vast number of experimental result to back it and none to cast it into doubt. |
Posted By: airmano
Date Posted: 12 March 2015 at 1:16pm
|
@QE: Can you read ?
I linked to an experiment in my post Airmano |
Posted By: Quranexplorer
Date Posted: 13 March 2015 at 6:18am
How can evolution within a species be the experimental evidence to suggest evolution of one species to another totally different species? |
Posted By: Quranexplorer
Date Posted: 13 March 2015 at 6:47am
That's what TE does--just says so many things--no observation, no experimental evidence!
It's all about evolution within a species. What has it got to do with the imaginations of one species evolving to another totally different species?
Don't say you don't use google.
Must be like UFOs--you only hear about it, never get to see one! |
Posted By: airmano
Date Posted: 14 March 2015 at 10:58am
QE:
Before we go any further: Can you tell me how you define "species" ? Would a tiger and a lion represent two different species for you ? Are wolfs and dogs of the same species ? Airmano |
Posted By: Quranexplorer
Date Posted: 14 March 2015 at 12:17pm
I can help you with this definition from the net. You should be able to answer the rest yourself. species ˈspiːʃiːz,-ʃɪz,ˈspiːs-/Submit noun 1. BIOLOGY a group of living organisms consisting of similar individuals capable of exchanging genes or interbreeding. The species is the principal natural taxonomic unit, ranking below a genus and denoted by a Latin binomial, e.g. Homo sapiens. synonyms: type, kind, sort; More 2. a kind or sort. "a species of invective at once tough and suave" synonyms: type, kind, sort; More |
Posted By: Tim the plumber
Date Posted: 14 March 2015 at 3:03pm
So do you count lions and tigers as the same or different species? I ask because they can interbreed in captivity but don't in the wild because they live in separate places. Obviously they were once the same species, in that they have a common ancestor. How about domestic cats? Do you count polar bears and grizzly bears as separate or the same? They sometimes do interbreed even in the wild. Polar bears are descended from grizzly bears. How do you view Shetland ponies and shire horses? They cannot functionally interbreed as the size makes it not really doable but with artificial insemination... The disease HIV has evolved from a similar disease in rhesus monkeys. It is, however, a different species of virus in most people's view. Obviously the divergence of species within human time scales is a lot less than over millions of years. |
Posted By: airmano
Date Posted: 14 March 2015 at 3:28pm
Now, to see whether you have any arguments beyond the ones copied from creationists pages, could you please try to answer the two other questions as well ? (or at least admit that you don't know if you can't) Airmano |
Posted By: Emettman
Date Posted: 15 March 2015 at 1:45am
Yes. A current favourite of mine is the relatively recent discovery that giraffes are just on the cusp of separating of different species despite *not* having any geographical separation of the diverging sub-species. http://news.bbc.co.uk/1/hi/sci/tech/7156146.stm Chris. |
Posted By: Ron Webb
Date Posted: 15 March 2015 at 8:06am
Chimpanzees did not become humans, any more than humans became chimps. Perhaps you should understand the theory before you criticise it. 
If you want the specific laws that relate DNA comparisons to ancestral distance, you can find them on the Internet, but I warn you that they involve some extremely complex mathematics. I'm certainly not qualified to discuss them, nor I suppose are you.
There are many such experiments, but you dismiss them all as being within species. One would not expect direct observation of evolution from one species to another, because that takes millions of years. But as I said, we don't need direct observation of species evolution any more than we need to directly observe your grandfather to know that you are related to your cousins. We have DNA evidence, which is regarded as conclusive beyond any reasonable doubt.
It's not speculation. DNA of chimpanzees and humans have been repeatedly compared in a variety of ways, and all estimates come up with about 2% difference. And as I keep saying, common ancestry is measured by DNA difference.
Now that is mere speculation.
You complain about lack of experimental evidence, and yet you postulate Intelligent Design??
You should probably read Darwin's Origin of Species. Darwin made decades of observation before formulating the theory.
No case is ever 100% perfect, but the fossil evidence is quite strong enough to make the case satisfactorily to any fair-minded individual. What I was saying is that you will never accept the evidence because there will always be gaps, albeit smaller and smaller gaps. Anyway, I'm not discussing fossil evidence here. The case I am making is that the DNA evidence, on its own, tells us that all living things share a common ancestry. We don't even need the fossils.
And yet law courts accept DNA evidence as conclusive beyond any reasonable doubt.  I'm not sure what kind of experimental evidence you want. Human DNA produces human beings; chimp DNA produces chimpanzees. You want somebody to create an intermediate creature by blending the two genomes somehow? It might be possible to do, but would it be ethical? And what would it prove anyway?
Maybe no advantages that are apparent to you, but they make perfect sense to me. Music, art and religion all play roles in social bonding and group identification. The ability to ponder the nature of the universe is fundamental to science, and is probably the ultimate survival advantage. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: biggerjohn
Date Posted: 18 March 2015 at 12:21pm
|
I am an artist. Give me a pen, paper, and enough time and I can create anything. I'm not saying it will look spectacular; but the only limit to what I can do with these tools is my imagination. I have a definite style when I draw, it is evident in all I do, fundamentally my work usually looks similar, yet at the same time no two drawings will ever be identical. Now the purpose of my ramblings here are simple. I believe that God is an artist as well (check out any sunset or rainbow... the things he can paint with a little bit of light and some water vapor is amazing). God has his set of tools that he works with... the elements, and with them he can create anything. He has a definite style, and while some things make look similar to others, no two creations are identical. Because the things around us and we ourselves are made of similar elements and have many traits and features in common... right down to our DNA, does not prove or even necessarily mean we evolved from some sort of primordial pool of soup. The way I see it is simple. Evolution is all about chance. Creationism is all about design. To some the evidence put forward at the start of this thread seems to prove evolution. To me it just proves there was one amazing artist behind it all. Always sincere... sometimes serious John B |
Posted By: Ron Webb
Date Posted: 18 March 2015 at 3:56pm
|
Hey Quranexplorer (or anyone), I'm curious to know what you think of a study like this: http://www.bbc.com/news/science-environment-31905764 - By Pallab Ghosh Science correspondent, BBC News It's exactly the same kind of analysis that measures the genetic distance between us and other primates. If it's valid for identifying tribal relationships, then why not species relationships? Or if it's not valid, then why is it considered valid for immediate families and distant cousins? ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Emettman
Date Posted: 19 March 2015 at 1:18am
It shows that increasing scientific knowledge can overturn things previously accepted as truth. (Including earlier scientific findings, if necessary, in the light of new information or better techniques!) The "Celtic fringe" as a unity is shown to be more mythic and less historical, an "everybody knows" which turns out to be less true than popularly believed, but I absolutely adore the detail that Devonians and the Cornish have viewed each other with distinct suspicion from their relative banks of the Tamar for millennia, not just centuries. Science is trumps. Chris (I type this from Cornwall) |
Posted By: airmano
Date Posted: 19 March 2015 at 5:45am
BiggerJohn:
Why does God keep on designing new and vicious diseases ? Airmano |
Posted By: Ron Webb
Date Posted: 19 March 2015 at 3:42pm
Welcome to the forum, John! (Can I call you John?  )
Is that what you would tell a judge in a paternity suit? "Just because my DNA matches closely with the child's, that does not prove we are related. It's just that the Creator has a certain style, and His creations tend to look similar." I don't think he'd buy it. No, you're missing the point. My DNA is something like 99.999% (don't quote me!) similar to my sister's. That is clear evidence that we have a common ancestor, and gives a good indication of how many generations ago -- just one in this case. My DNA is also something like 99.9% (again, don't quote me!) similar to yours. That is clear evidence that we also have a common ancestor (about 50,000 years ago, IIRC). My DNA is also about 98% similar to a chimpanzee. Why is this not equally strong evidence of common ancestry, estimated to be about ten million years ago?
Actually, evolution is all about natural selection, which is the opposite of chance. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: biggerjohn
Date Posted: 19 March 2015 at 5:22pm
|
Thanks, and please call me John
Actually I'd tell the judge in the paternity suit it couldn't have been me..... I was ummmm... in Albuquerque nine months ago... yeah, that's it
 You have some good points, unfortunately I have no time right now (already 20 minutes late). I'll try and pick this up again tomorrow.
Always sincere.... sometimes serious,
John B
|
Posted By: Quranexplorer
Date Posted: 20 March 2015 at 7:10am
Let me phrase it this way to avoid these excuses with terminologies [IMG]smileys/smiley2.gif" align="middle" /> : There is no observational evidence for a non-human becoming a human being.
I agree I am not a a specialist to discuss these extremely complex mathematical equations. But that doesn't take away the fact that there is no universal law which links 2 different DNAs as a function of the assumptions made under the theory of evolution.
All these experiments you mention have the same creature (I don't want to use the term species as people seems to be interested in finding an excuse around this definition [IMG]smileys/smiley2.gif" align="middle" />) at the beginning of the experiment and at the end of the experiment--an E.coli bacteria at the beginning of the experiment still remains and E.coli at the end of the experiment. The changes within a particular creature is a fact whether you call it evolution or something else-- because all the human beings who originated from a single pair of human beings originally are now so diverse with so many different races. My points are: 1. The changes observed within a creature does not automatically prove that such changes can bring about a change of one creature to another. If you think that is possible, why not the the same experiments where the E.coli evolves over a number of stages be used to evolve that E.coli to something other than an E.coli? 2. You are just saying a 2% DNA difference between humans and chimpanzees suggest a common ancestor some million years ago--I'm saying it's just an assumption as there is no experimental evidence or observational evidence--even the historic fossil evidence fail to provide a complete chain showing the transition of one creature to another.
If we try to put your whole DNA argument is simple terms: DNA2=DNA1+function of something The points to note are: 1. No clue on how so much intelligent information originally came in DNA1 2. No credible explanation for the real process of DNA1 getting transformed to DNA2 3. No experimental or observational evidence for even one transition of DNA1 to DNA2. All you are saying is 2% is a small number and why not blindly take it as an evidence for a common ancestor!![IMG]smileys/smiley2.gif" align="middle" />.
But that is closer to reality as there in no credible evidence to suggest chimpanzees and humans share a common ancestor!
I fully understand that Intelligent Design cannot be proved, and the whole point I am making is so is TE--it's only a belief and I have no problems if we are on the same page on this [IMG]smileys/smiley2.gif" align="middle" />
How could he possibly observe something which you say only happens in a million of years?
May be the whole TE makes sense to someone as a faith based belief. But it certainly does not make it a fact.
My point is DNA evidence to connect 2 human beings does not automatically connect humans to the next closer species ! If human DNA always produces human being and chimp DNA always produces chimpanzees, then why the confusion of linking 2% DNA difference to a common ancestor a million years ago when there is no evidence for such a connection?
I can�t see that. I don�t see anybody at survival risk for not being a musician, an artist, a religious guy or a science enthusiast. |
Posted By: biggerjohn
Date Posted: 20 March 2015 at 5:13pm
|
I want to try something different for a moment (different at least for me) let�s pretend for a moment that I do not believe in God or �intelligent design�. Earlier, when I wrote of some �primordial pool of soup� I was only being a little sarcastic (had I used my original wording �primordial sludge� then that would have been really sarcastic J). However, since that time I have been reflecting on the concept. In all seriousness, I should have said Primordial Ocean, because that is now pretty much how I envision the start of life on this planet. This primordial ocean was a vast body of water teaming with raw matter, ripe for life to begin. I would also like to amend my use of the word �chance�; not necessarily in favor of �natural selection� (I�ll get to that later) but in favor of the idea that the emergence of life, when conditions are just right, is almost inevitable. Life is aggressive, it fights to take hold and survive. Even in some of the most inhospitable places on earth, miles underneath the ocean surface or at sub-zero temperatures imbedded in rock, life persists, even thrives. Look up �Riftia pachyptila� (Giant Tube Worms), and �Green Algae� in Antarctica. LIFE HAPPENS! Stopping it from happening might actually be the real challenge� the weeds in my backyard are proof of that. J The significance of all of this is the idea that I do not think that it was just one super organism, stronger than all the octillion failed organisms, that crawled up onto land, sprouted legs, and then became the common ancestor of all life on this planet. I think life would have just exploded from that ocean with countless organisms thriving, taking hold and developing. Many things would have emerged from that state. They would have all been similar, made of the same basic raw elements, and all related (for the exact same reason why they are similar). Evolutions does not have to mean all species are descended from any one common ancestor. The vast number of species that call this planet home are varied and complex. To me at least multiple ancestors make more sense. I don�t think there is much plant DNA in me (aside from perhaps the salad I had last night) and I would like to think I�m not too closely related to cockroaches. I Don�t have much of a problem with the thought of being related to chimp or a bear (the bear part would explain much of my appetite). Were I to subscribe to the theory of Evolution I would most definitely lean towards an opinion of multiple ancestors not all directly related to every other species. OK, pretend time over� back to being a close minded Creationist J. For me it has always been a question of design or not? Did life emerge and evolve simply because that is what life does (which is quite plausible), or was there a higher intelligence who planned, orchestrated, and guided the formation of life here? My vote is for the higher intelligence. Always sincere�. sometimes serious, John B I will have to venture into the whole �survival of the fittest/natural selection� aspect of things come Monday or Tuesday. THE WEEKEND IS HERE� AND I AM NOT!!!! |
Posted By: Quranexplorer
Date Posted: 21 March 2015 at 6:37am
|
Hi Ron,
For me the whole study fits very well with concept of the whole humanity originating from a single pair of humans originally and then developing and acquiring all these diversities within the human species. DNA evidence to connect human to human is a natural outcome of the observation that a human DNA always generates only a human DNA. There is nothing in this study suggesting that the DNA evidence within the human species suggesting a common origin can be extrapolated to link humans to a non-human origin. There is no experimental evidence, no observational evidence and not even one complete fossil evidence!
|
Posted By: airmano
Date Posted: 24 March 2015 at 3:36am
John
Any idea on How and Why God does this ? Why there are so many flaws in the design ? Why don't we have a "natural resistance" against (genetic) diseases ? Why does God keep on designing new and vicious diseases ? ----------------------------------------------------- QE: http://en.wikipedia.org/wiki/HIV - HIV is nowadays considered as a species of its own. We do also know where it originally came from. And now ? Airmano |
Posted By: biggerjohn
Date Posted: 24 March 2015 at 4:38pm
HOW... I do not understand how God does all these things... my mind is often blown by how complex and amazing life is. I do not think I see the same flaws in nature as you do. I don't think of death as a flaw. I don't think that death by disease is a flaw (OK that sounded weird... but I'll still let it stand). There are many ways to die, disease is just one. That said, much of what we suffer from is our own doing... until recent years I was heading down a path that was likely to end with the words "Death by Hamburger" etched on my tombstone.
WHY... Life is about gaining experience, growing, and learning. A life without challenges is a life without advancement and betterment. Opposition is how we grow. Interestingly enough that is one of the fundamental elements of "natural selection/survival of the fittest."
Having now said all of the above, I must now add the following.... "Life is not FAIR." It simply isn't. But I do not believe that this life is all that there is. I very much believe that while life is not fair, eternity is.... thanks to God.
Always sincere... sometimes serious,
John B
|
Posted By: biggerjohn
Date Posted: 24 March 2015 at 4:39pm
|
As I understand it �natural selection� is all about adapting, developing, persisting, and surviving�. �Survival of the fittest.� Simply put, those life forms that are the best at adapting, best at developing and changing, they are the ones that survive. Those species (or sub-species) that don�t adapt well enough don�t survive; and the opposite of survival is extinction. My thoughts: There are myriads of different life forms on this planet. The number of species and subspecies within just the insect world is staggering. Now let�s combine that with all the different forms of life that thrive in our oceans. If that is not overwhelming enough yet let�s add birds to that mix, reptiles too, mammals, primates, etc.. The numbers of species that call this planet home is mind blowing. Of all the species that have had any kind of existence on this planet, how many do you think have gone extinct? How many species have we seen go extinct in the past few hundred years (after all, as humans we are pretty lousy caretakers)? I would venture to say that, percentage wise, the number of species and or sub-species that have gone extinct is low. Furthermore, many that have gone extinct (such as dinosaurs) may have done so because of some catastrophic event and not as a result of �natural selection.� I think that the traditional model of only the strongest or fittest species thriving and surviving is inaccurate. Consider for a moment Canines; I am not even going to venture a guess at the number of species and sub-species there are, but that number would be massive, and likely still growing. Which breed would most consider more �fit�, a German Shepherd or a Chihuahua? How about a Pit-bull or a Pomeranian? Each of these breeds is just as prolific as the other� actually the Chihuahua is likely more prolific then them all (does that actually make Chihuahuas the FITTEST?!� J). If only the strongest survived I do not imagine there would be nearly as many dog breeds in the world today as there are now. The prevailing opinion in relation to �Natural Selection� and �Survival of the Fittest� seems to be that life is ever looking for new ways to improve; essentially engaging in a near endless loop of trial and error, failure and success (actually it is thought to be more like failure, failure, failure, failure, success, failure, failure, success, failure, failure, failure�.). I don�t think that that is quite how it works. I think life is stubborn and doesn�t ever give up easily. I think that the vast majority of life on this planet is strong and very resistant to extinction. I do not believe that just the fittest survive. I do not believe that nature is as cutthroat as man is; indeed I think that the whole concept of �survival of the fittest� may very well be a result of us projecting our own thinking on the natural world around us. The more I ponder over the world with all of its amazing life, beauty, and strength, the more I am convinced that there is a power behind it all. A creator and an organizer. Always sincere�sometimes serious, John B |
Posted By: Ron Webb
Date Posted: 24 March 2015 at 8:56pm
I'm not sure what you mean by "observational evidence", but if you are limiting yourself to what can be directly observed, then you are discarding 90% of science. How many scientific disciplines rely solely on what can be directly observed? Can we directly observe the atoms in a molecule, or the interior of the earth?
No non-human ever became a human. Are you sure you understand the theory?
So when an evolutionary biologist says that 2% difference corresponds with a common ancestor about ten million years ago, you think he's just pulling a number out of his, umm, head? You admit you're not qualified to discuss this, so how can you just casually dismiss their calculations? I don't know if you'd call it a universal law, but there is a generally agreed-upon approach to using DNA markers to estimate the time to most recent common ancestor (TMRCA). You can read about various models http://nitro.biosci.arizona.edu/ftdna/TMRCA.html - here . I suggest you click on the "Quick version" link. The "very technical details" made my head hurt, and it's not even the most technical explanation I have seen.
Because it would take longer than the lifetime of the human experimenter. But please explain what you mean by "creature". There is a pretty compelling fossil record showing the progression of the ancient eohippus to modern day horses and zebras over fifty million years. Are the eohippus, the modern horse and the zebra all the same "creature"?
If I had DNA evidence showing that you and your cousin shared a common ancestor (i.e., your grandparents), would I need experimental or observational evidence to back it up? Do I need to dig up your grandfather's grave?
I'm not sure what this is supposed to mean. DNA2 is not just DNA1 with other stuff added to it. Again, that's not how evolution works.
1. It's called natural selection. 2. It's called mutation. 3. We have oodles of evidence of DNA transitions. What you're looking for is evidence that crosses some arbitrary "creature" boundary. Unfortunately you haven't defined this boundary, nor offered any mechanism that could explain how it is determined or why it cannot be crossed.
I'm applying exactly the same rules of evidence for a common ancestor between chimps and humans as we use to demonstrate a common ancestor between you and your cousin. There's nothing blind about it.
Why not? Why is it valid to compare you and your cousin's DNA, but not to compare human and chimp DNA? Ah yes, that nebulous "creature boundary"!
It's not about individual survival. It's about tribal or species survival. You don't think that belief in a divine protector or a heavenly reward might encourage warriors to fight harder and longer to protect their tribe, or conquer other tribes? You don't think songs and stories lauding brave soldiers might do the same? ------------- Addeenul �Aql � Religion is intellect. |
Posted By: airmano
Date Posted: 27 March 2015 at 4:56am
|
@QE
...and you still haven't answered the question whether wolfs/dogs and tiger/lions are of the same species for you (or not). Strange isn't it ? Airmano |
Posted By: Quranexplorer
Date Posted: 27 March 2015 at 7:25am
I'm not saying observational evidence is mandatory, but there should be at least some evidence to make a theory look plausible--TE has no credible evidence to prove the transition of one species to another.
Great! Based on your statement at least we are clear that human beings have a stand-alone origin with no genetic connection whatsoever with other non-human beings.
You are not getting the point my friend. Just have a read at what they have written and you can clearly see that all their calculations are based on some basic assumptions: There are two fundamental assumptions we need to deal with in order to translate an observed number of mutational differences into a probability distribution for the TMRCA: We must count the true number of mutations and we must be able to determine the rate of the clock (i.e., assumptions about the mutation rate) Now the funny part is that what they are trying to fix through assumptions are again things that are the assumptions under a theory that have no proof whatsoever: random mutations--just an assumption mutation rate--just an assumption My point is that the fundamentals of the theory of evolution itself are at best only assumptions and then what you do is add more assumptions to these assumptions to fix some imaginary parameters and then run a probabilistic model to determine another approximate TMRCA--the whole thing is just only assumptions on assumptions and nothing else. The hilarious part still is that then you project this very TMRCA as a proof for the very theory the assumptions under which have been used as the basis for calculating the TMRCA
I can clarify what I mean by the "creature":the eohippus, the modern horse and the zebra are all different creatures. Now referring to your TMRCA link, the assumption is 1 mutation happens in every 500 generations. So if the E.Coli could have 12 mutations in a lab, why not an experiment be designed to cross at least one creature barrier?
As I already explained, you have a strong observational evidence that a human DNA always produces a human DNA and I have no problems in accepting a scientific tool that has practically demonstrated its effectiveness over a considerable number of cases with a very low margin of error in establishing genetic lineage within humans. But how on earth the same DNA analysis be extrapolated to establish a human to non-human genetic connection with no evidence at all!
1 and 2 are concepts in paper with no credible evidence. 3. I have already explained what I mean by "creature": the eohippus, the modern horse and the zebra are all different creatures. The "creature" boundary is less stringent compared to the "species" boundary to cross based on the kind of definitions we have. But unfortunately there are no credible evidence to establish the assumptions made under TE as facts for any of these boundary crossings.
There are no evidence for the assumptions under TE bringing about changes that can cause "creature" or "species" changes. As I already explained the argument that DNA analysis proves evolution itself is wrong as the very method uses the assumptions under TE as facts to come at the TMRCA
I'm not sure if you still want to keep the title of the thread the same--results from an analysis assuming the assumptions under a theory as facts being projected as the proof for that very theory
Great! That's why we don't see any of those non-fighting humans including women being religious or interested in songs and stories.
|
Posted By: Quranexplorer
Date Posted: 28 March 2015 at 11:32am
As I already mentioned, the definition is clear and the facts are verifiable for someone to reach own conclusions. However, since you insist, here we go: The definition I gave you is based on interbreeding and I think Tim the plumber already confirmed that interbreeding is possible between the above pairs and so these pairs should be falling under the same species according to the definition, I think. |
Posted By: airmano
Date Posted: 29 March 2015 at 11:43pm
|
@QE
At least you say "I think" at the end of your last sentence, indicating that you're not sure . By doing so you implicitly admit that the definition of "species" is by far not as clear as you tried to insinuate in your earlier wall of smoke. That's also why the term "creating a new species" is a rather pointless one. Although dogs and wolves are still sort of the same species, a chiwawa and a wolf could barely interbreed for purely "technical reasons". With your definition you could as well look at them as two different species (not capable of interbreeding) with the Chiwawa being man-made. Looking at http://blogs.scientificamerican.com/thoughtful-animal/2012/04/30/dogs-but-not-wolves-use-humans-as-tools/ - Dogs and Wolves they show some distinct differences over only 15-30ky already (hardly striving for "breeding goals" until very recently anyway). Why is it so difficult to extrapolate that they could/would separate into two different species (= "rather different animals") after millions of years ? BTW: what's about this one: http://en.wikipedia.org/wiki/Humanzee - Humanzee and: In disagreement to what you say there is a rather clear idea on when/how humans and apes split: http://en.wikipedia.org/wiki/Chimpanzee-human_last_common_ancestor - Human Ancestor To finish: You still haven't come up with a better model which could explain why the DNA within the apes (and relative to us) is so similar. Airmano |
Posted By: Ron Webb
Date Posted: 30 March 2015 at 12:12pm
Of course you're saying its mandatory. That's what you've been demanding throughout this discussion.
Okay, I was kidding before about your not understanding the theory (the point being that changes occur between generations, not within an individual), but now I'm beginning to think that you really don't understand it. Your constant demand for direct evidence of species change is counter to evolution theory, which postulates that such change is gradual, over millions of years. If somebody demonstrated a species change in a lab, that would more likely be evidence against evolution, not for it. I think part of the problem is that you look horizontally, across the tips of the branches of the evolutionary tree of life, and you see very distinct species. And so you expect to find the same kind of species distiction in the vertical direction, along the limbs and branches as well. But that's not how it works. A chimp and a human are obviously different, and nobody would expect a chimp to give birth to a human or vice versa. If we take the definition of species to be the ability to interbreed and create viable offspring, then we would never expect an animal to give birth to an infant of a different species (let alone "become" a different species). And yet, over thousands of generations, the species genome (as encoded in DNA) gradually changes. We can see those changes by direct observation as well as by experimentation. We can also see the eventual effect of those changes over millions of years in the fossil record, and by comparing DNA of related species, which documents the family relationships among current species and confirms the predictions of the theory of evolution.
Sorry, you're misreading the page. (Not terribly surprising because it wasn't written with non-technical readers in mind.) These are two assumption made in the mathematical model, not in the theory of evolution. The model only works if those two assumptions hold true, but both assumptions have been exhaustively studied and confirmed experimentally and observationally.
That's not a definition. It's just an arbitrary statement. Why are they different creatures, and why does it matter to evolution?
Because there is no such thing as a "creature barrier". Unless you mean a transition from one contemporary species to another (from leaf to leaf in the family tree), which won't happen because that's not how evolution works.
The DNA analysis is the evidence. (Well, that plus the abundant fossil record.) You want to erect a mythical "creature barrier" with no evidence at all. Not even an adequate definition of what you mean by "creature", let alone any suggestion of why mutations should know to stay within its boundaries.
I would respond to this if I could figure out what point you are trying to make. You only have to look at groups like Al Queda and ISIS to see how religious convictions (true or false) can inspire warriors to self-sacrifice and thus promote the ideology -- and the genome. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Tim the plumber
Date Posted: 02 April 2015 at 12:40pm
OK, so you say that lions and tigers are the same species. What about house cats? With artifical insemination you could probably get an interbreeding. How about donkeys and horses and zebras? I know it sounds like I am being just a devil's advocate and winding you up but this is the problem. What ever definition of species you use there are vast numbers of examples where it is difficult to say which side of the line it falls. The genetic difference between humans and chimps is less than that between donkeys and zebras. If you call donkeys, horses and zebras the same species then all of the great apes and the same species. |
Posted By: Quranexplorer
Date Posted: 04 April 2015 at 6:12am
The whole point I have been making from the beginning is that TE is a set of assumptions with no credible evidence at all: 1. When we talk about observational evidences, you say it�s not possible as allegedly the theory assumes these changes happen in millions of years�so for whatever reason, we don�t have any observational evidence. 2. When we talk about experimental evidence, you say it�s not possible for 1) thanks to the millions of years assumption 2) you think it�s actually counter to the theory(?)�so for whatever reason, we don�t have experimental evidence. 3. Now coming to the transitional fossils which was the biggest worry for Darwin, still remains a worry as there are no credible signs of such a thing. Based on the above facts when I say TE is just a theory, you say even gravitation is a theory�but again that argument doesn�t stand as gravitation has clear observational and experimental evidence to its credit. Then you say leave all these evidences and just look at the DNA evidence, which as I explained earlier is not an independent proof as it�s just a mathematical model based on the assumptions under the very TE which it tries to prove. So based on the above, the objective part is clear�TE has no proof and can never be proved and even as a theory it�s far inferior to its other family members. The only point of discussion remaining now is the subjective part�whether one should choose to believe in TE based on one�s own reasons and judgements�as I have made clear many times earlier, this is absolutely a personal choice. What is surprising though is the visible double standards of the proponents of TE�they would fight with tooth and nail and ask for proofs when someone says the visible signs around us clearly points to an ultimate creator, but have no qualms whatsoever to accept a theory with no proofs at all as fact! Now coming to the subjective part on reasoning, is it not surprising that a book 1400 years ago, wherever it agrees with modern science when it makes any scientific references gets it absolutely spot on, and wherever it differs from modern science, the modern science is left wanting for proofs and with serious criticisms�in all these there are signs for those choose to think in the right direction.
Come on, you made a statement on the theory, I just restated it in more explicit terms and then you come with an explanation that your earlier statement was in fact not correct and then you blame it on my understanding�in fact it seems the whole thing just shows a lack of your understanding or your inability to state things unambiguously�anyway, I won�t waste time on such discussions as I think people tend to divert to such discussions when they face a massive lack of real arguments. Coming to the second part of your explanation, I have no problems with your theoretical beliefs. But when it comes to evidences, I can see lot of contradicting statements: 1. You say direct evidence for evolution is counter to TE, but at the same time you say �We can see those changes by direct observation as well as by experimentation��so what are you trying to say? You have observational and experimental evidence or you don�t have? 2. You say you can see the evidence in millions of years of fossil records, but at the same time you don�t see even one complete transitional fossils for transition of one species to another, and someone even says it is not possible to have these fossil records as they simply do not survive for such long durations�so where do you have these fossil records? 3. Comparison of DNA evidence�a scientific evidence for a theory has to be independent of the assumptions under the theory which is not the case with the DNA analysis in your link
I think the thermal engineering texts from my university days had more complex stuff than what is written in that link. But if you think there is something you find too technical, let me know and In Sha Allah I can explain you�but again I prefer not to waste time on such discussions that people tend to divert when facing shortage of real arguments. However, we have more wrong statements and contradictions here: 1. You say mutation is not an assumption under evolution�you are wrong, it is. 2. If you say the evolutionary changes happens in millions of years which in fact depend on mutations and then you say the evolutionary changes can neither be observed and nor be experimentally shown�then how on earth you say random mutations and mutation rates have been studied and confirmed observationally and experimentally? Ultimately both the theory and the model are based on assumptions and some common ones�how can such a model provide an independent proof for evolution?
Here�s the definition. The individual creatures/organisms are different as we see now and they matter to evolution because evolution postulates that all these individual creatures had a common descent, but fails to provide any proof whatsoever: creature ˈkriːtʃə/ noun 1. 1. an animal, as distinct from a human being. "night sounds of birds and other creatures" synonyms: animal, beast, brute; More o o o 2. 2. a person or organization considered to be under the complete control of another. "the village teacher was expected to be the creature of his employer" synonyms: minion, lackey, flunkey, hireling, subordinate, servant, retainer,vassal; More
As I already mentioned, I have no problems with one�s theoretical beliefs. In reality, you have no proof whatsoever for one to take evolution as a fact.
DNA analysis not an evidence as long as you run the TMRCA model on a set of assumptions some common to the theory itself. A creature is an individual organism as defined above. You have no proof whatsoever to suggest mutation leading to change of species. Even from a subjective reasoning point of view, all known mutations have been causing negative impacts leading to inferior results and not something that correlates to better survival.
The point is that many behavioural and cognitive traits in humans do not show any real correlation with survival. It was not wars that necessitated humans to develop religion, but it was the other way around in many cases�so here the survival need came after the trait, maybe you need a reverse evolution to explain the trait of religion based on your argument. And even songs and stories�you will see more of the songs and stories as a means to satisfy the softer sides of human emotions like love, happiness, sorrows etc. rather than exhorting men for wars�so again these doesn�t correlate with the survival advantage. Coming to Al Queda, ISIS etc. I am just puzzled as any true Muslim would be that how could men perform such atrocities to humanity in the name of religion. Yet, again it was the religion that came first, then people are getting misguided, manipulated and maybe politically used to carry out these self sacrifices etc� so here again the survival need came after the trait, still you may need a reverse evolution to explain this based on your argument.
|
Posted By: Tim the plumber
Date Posted: 04 April 2015 at 11:17am
|
QE, You have written a lot but not answered my question; How do you define species? Your bringing in examples of human behaviour which do not seem to fit with a 100% competetive world is reasonable. But this is studied by science. The advantages of cooperation and in being trusted and like by your fellows very often out weigh any short term advantage. This is a big subject in the science of behavioural evolution. The defining species thing is the most important bit though. Once you choose a definition you will see that it will never really work and automatically produces the evidence you keep asking for. |
Posted By: Ron Webb
Date Posted: 04 April 2015 at 6:46pm
I'm saying that it's not possible to directly observe evolution from one species ("creature"?) to another because that would take millions of years. Anyone who claims to have done so in a lab would be talking about some other process, e.g. genetic engineering, but not evolution.
When did I say that? There is plenty of experimental evidence that evolution happens. However, these experiments can only be done on a relatively small scale (minor adaptations). It would take millions of years for these minor adaptations and mutations to accumulate to the point where the beginning and ending animals could be considered different species, i.e., to the point where they are so different that successful interbreeding would be impossible.
Please read the Wikipedia entry on http://en.wikipedia.org/wiki/Transitional_fossil - transitional fossils , which gives an excellent explanation along with lots of examples.
We still can't directly observe gravity waves. And although we can measure the gravitational attraction between to large objects in a lab, no one has directly measured the gravitational attraction between planets or between the sun and the earth. I suppose it's still possible that God, not gravity, keeps the heavenly bodies in their orbits exactly as if gravity were doing so, but without universal gravitation. So maybe universal gravitation is "just a theory" too.
Yes, and the law of universal gravitation is just a mathematical model too.
The God hypothesis requires an extraordinarily high standard of proof because it is an extraordinary claim, i.e. it hypothesizes a Being utterly unlike anything in the natural world. Also, it is merely a hypothesis, not a proper theory. A theory should actually explain something to be taken seriously. Saying "God did it" is not an explanation; it just gives a name to our ignorance.
The Quran is full of errors and inconsistencies. I actually http://www.islamicity.com/forum/forum_posts.asp?TID=31123&PID=196263#196263 - mentioned one just this afternoon. Or just Google "Quran errors" and take your pick.
No, your restatement shows that you don't know the difference between evolution and http://en.wikipedia.org/wiki/Lamarckism - Lamarckism . No non-human ever became a human. It would make more sense to say that a non-human gave birth to a human. But that would be wrong too, for the reason I have already explained: species transition takes millions of years and is never accomplished in a single generation.
Random mutations are not an assumption. They are an observed fact. Are you doubting that mutations take place?
A species change would take thousands or millions of mutations. We can observe only a few at a time.
Your definition doesn't explain how to distinguish one type of creature from another; i.e., how we know when we've crossed the "creature barrier".
So what? The theory of evolution doesn't require that every behaviour or trait must be adaptive. It only requires that they are not maladaptive. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Quranexplorer
Date Posted: 05 April 2015 at 1:50am
|
Hi Tim,
Even I wish I could have a shorter turnaround time with my responses. But with the current demands it's simply not possible for me to respond quicker. The problem with the definition of biological terms like species is that they basically take the very basis for these definitions from the theory of evolution itself. So: 1. How can these definitions be an independent evidence for the theory? 2. What we need are real repeatable experimental or observational evidences and not theoretical definitions as evidences.
|
Posted By: Tim the plumber
Date Posted: 06 April 2015 at 3:19am
I am not after the scientific definition. I am after yours. The problem you will have is that whatever definition you use I can give you examples where there is a species just about to passover the line or has just passed over it. Those examples are the direct evidence you ask for. I cannot do that untill we agree what definition of species to use. I am happy to use which ever definition you wish to. It will not matter. There will always be loads of examples. If you are after an experiment to do in your own kitchen I can describe that as well. |
Posted By: Quranexplorer
Date Posted: 10 April 2015 at 7:53am
So here we have an agreement that at present we have no observational evidence for evolution bringing about a species change and we can never have also.
So here we have an agreement that the experimental evidence for evolutionary changes are limited to small adaptations within a single species or rather individual creatures/organisms and there are no experimental evidence for species changes.
Thanks for that link from which it is very clear that the fossil records can never be definitive evidence for evolution: 1. The overall fossil records are extremely small that the number of known species through fossil records are far less than even 1% 2. Even the available fossil records are necessarily incomplete that there is no way one can definitively say a fossil record represents certain level of divergence between two end points. It's all only assumptions.
Great! See you are getting closer. If you are open for a critical analysis of the theory of gravitation which has got clear observational and experimental evidence and the support of a law which works in most situations, why not do the same for a theory that has got no evidence at all
But you still remain ignorant even if you reject Allah. There is no single perfect theory which can explain a natural phenomenon completely let alone the entire universe. The realm of Allah lies much above what human mind can perceive and when you can't even explain his creations completely, how can you expect a mere creation with his imperfect tools to prove Allah.
I have had many discussions in this forum, but never got anyone coming with a definitive and conclusive proof to establish an error in Quran. All were just speculations and assumptions more like the theory of evolution and some personal opinions. I can sure check what you have got in your new post.
I never got in to the process by which you assume evolution takes place. All I said was the idea of an individual creature or species evolving to another through evolution is not substantiated by any evidence, whether you say it happens in millions of years or not.
Random mutations are a fact, but the hypothesis that such random mutations can bring about species changes is an assumption.
Nobody is sure if a species change will take thousand or million mutations�so the mutation rate can only be an assumption.
The definition should not be a worry in this case as one can never prove that the barrier between an individual creature with a common name �horse� and another individual creature with a common name �zebra� was ever crossed and similarly for any creature with a unique common name.
I have no problems, as the whole theory of evolution really falls in to more of a belief category, you can try linking traits like religion, stories, songs, science etc. to survival first and if that doesn�t make sense then maybe try another option! |
Posted By: Quranexplorer
Date Posted: 10 April 2015 at 8:06am
I have already given the species definition before and if you think that definition proves evolution despite the fact that TE has no scientific observational or experimental evidence--then you are free to keep your beliefs, as I already mentioned that I have no problems with what people choose to believe. |
Posted By: airmano
Date Posted: 13 April 2015 at 3:39am
QE
Inform yourself first please before making such statements, here: http://en.wikipedia.org/wiki/Mutation_rate - Mutation rate Airmano |
Posted By: Quranexplorer
Date Posted: 14 April 2015 at 1:56am
The upper and lower limits to which mutation rates can evolve is the subject of ongoing investigation. |
Posted By: airmano
Date Posted: 15 April 2015 at 7:58am
QE:
When you look at the very important http://en.wikipedia.org/wiki/Planck_constant - "Plank constant: h" you'll find that the last two digits are written in parenthesis. This is our present limit of knowledge. But before you bring up your usual phrase of human imperfection: To how many digits did the Quran (correctly) forecast the http://en.wikipedia.org/wiki/Gravitational_constant - gravitational constant: "G" again ? Airmano |
Posted By: Tim the plumber
Date Posted: 15 April 2015 at 12:04pm
No you can't define the exact rate of change of a species. But it is reasonable to give it a "somewhere between x and y" value. This is altered by such things as exposure to stress such as starvation or extremes of temperature. If a population is subject to a toxin or aomething then the chance of a birth going to plan is less. The chance of a mutation happening is greater. Also keep in mind that normally evolution has already optimized a species for its niche. If a zebra is born with more slender legs then it might run a little faster but it will probably break one of them. So that is probably a disadvantage. Not so for a race horse. |
Posted By: Ron Webb
Date Posted: 16 April 2015 at 4:53pm
(Sorry for the delay -- I lost track of this discussion somehow.)
Your insistence on "observational evidence" (as you are defining it) is unrealistic and not in keeping with modern science. I don't have observational evidence that my parents ever had sex, either. Nonetheless, the evidence I do have is compelling. I don't need observational evidence, thanks!
You still have this notion that there is some kind of species or creature barrier that needs to be overcome. I think you still don't understand that the species distinctions you are talking exist only for contemporary species. There is no clear line separating species as they evolve. Again, the analogy of the "tree of life" is helpful. If one looks at a horizontal cross-section of a tree, you will find distinct branches and twigs. If you traverse the tree vertically, however, you find continuous limbs from the root to the tips of the branches. There is no species or creature barrier to be crossed. If we can travel an inch, there is no reason in principle why we can't travel a hundred feet.
Yes, and the number of known stars is less than 0.000000000001% (give or take a bunch of zeroes) of the total number of stars. That doesn't stop us from having a good understanding about the process of stellar evolution.
Yes, it's hard to be precise about the time scale. As I said, the transformations along the vertical axis of the tree of life are continuous and gradual. But we can definitely see the transformations. There is no assumption about that.
I guess you missed the sarcasm. Sorry, but I'm not open for a critical analysis of the theory of universal gravitation, and I'm appalled that you apparently are. If you're that anti-science, there may not be much basis for us to discuss anything. For decades the "theory" of gravity has successfully piloted spacecraft to the moon, to Mars and beyond. This is despite the fact that there was absolutely no "observational" (by your definition) evidence, and scant experimental evidence at best, for it at the time. My point is that we don't need direct observation of a phenomemon to have confidence in the theory behind it. If we did, most of modern science (including the science that brought you the machine on which you are reading this) would not be possible.
Nobody ever said that a horse became a zebra or vice versa. How many times do I have to tell you this? ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Quranexplorer
Date Posted: 18 April 2015 at 4:07am
Parenthood of a child is a matter of faith and trust between the parties involved until the point that trust is broken, beyond which it just falls in to that category of disputes which will have to be settled based on clear proofs. So if your endorsement of the theory of evolution is based on such faith and trust, then I have no problems, as I have made it clear countless times that I completely respect one's choice of his beliefs. Now that you say TE is incapable to establish the kind of evidence that one would normally expect for the kind of claims made under TE, if you wish you may present whatever evidence you have--only in case you have it, don't trouble yourself too much [IMG]smileys/smiley2.gif" align="middle" />
You agree the species distinction exists in contemporary species--so the species barrier is a reality now and you never see this barrier broken in reality. You then say the species barrier is a notion--that sounds a contradictory statement to me. I think the problem is that your arguments start with the premises that TE is a fact, but it is not and unless you break this notion you won't be able to look for objective evidence to prove this theory and that to me is something detrimental to the scientific methods--I think we have got more barriers to break than I initially thought [IMG]smileys/smiley2.gif" align="middle" /> If things were so simple to say that travelling an inch automatically implies that you can travel a hundred feet, then I would suppose that with the same aircraft that goes up in the sky one can simply go to planets like Jupiter or Saturn�but it doesn�t happen so, there are barriers one need to cross to make such things happen and it doesn�t make any sense to blindly believe that such barriers are broken just like that, without any compelling evidence for such happenings.
Are you saying stellar evolution is universally and unanimously accepted as a fact without any evidence or critical analyses, the same way you argue the theory of evolution should be accepted?
But the hypothesis that such transformations bring about species changes is an assumption.
By now I know you can�t even think of thinking something outside these theories�I just chose to ignore your sarcasm. [IMG]smileys/smiley2.gif" align="middle" /> Even though I don�t see the gravitational field, I don�t see any need for me to dispute the theory of gravitation as there is a compelling observational evidence that an apple always falls down to the earth and it always happened and still happens that way whether Newton formulated his theory of universal gravitation or not. I am not anti-science and I would say there is nothing more anti-science than saying that something is not open for critical analysis. In that case Einstein would have been anti-science that he chose to critically analyse Newtonian mechanics and modify it to fit for relativistic regimes. I am only against the idea of using science as an excuse to deny Allah�because that is such a poor excuse! |
Posted By: Quranexplorer
Date Posted: 18 April 2015 at 4:13am
I just mentioned it in more straight forward terms that mutation rate is an assumption. Of course you can add adjectives like "reasonable" etc. based on your level of faith in the theory. |
Posted By: Quranexplorer
Date Posted: 18 April 2015 at 4:22am
I didn't know that Quran has defined "G" also. If you don't mind, can you please share the relevant verse so that I can have a look at it? |
Posted By: Ron Webb
Date Posted: 19 April 2015 at 10:33am
My endorsement of the theory of evolution is based on the same "clear proof" that any court of law would accept to confirm my parentage. DNA establishes both beyond any reasonable doubt.
One would not normally expect direct observational evidence of evolution any more than one would expect direct observational evidence of my parentage.
Contemporary species are distinct, just as you and I are distinct individuals; but that doesn't imply any "barrier". Nobody is suggesting that contemporary species evolve into one another, any more than you or I might evolve into one another. No "barrier" is necessary or even logically meaningful.
There is a very obvious barrier preventing an aircraft flying to other planets -- millions of miles of vacuum. What is the barrier preventing the ancient eohippus gradually evolving through various stages (identified fairly arbitrarily as different "species" but in reality making a smooth transition) into the modern horse?
We have plenty of evidence of stellar evolution. However, no one has continuously observed the entire process of the formation of a star from a giant cloud of gas to a supernova and beyond. Certainly no one has created a star in a laboratory. And the vast, vast majority of stars in the universe (like the vast majority of ancient species) will never be available to us for direct observation. Nonetheless: yes, I would say that the general theory of stellar evolution is universally and unanimously accepted. Nobody insists on direct observation (as you define it).
The theory of gravity, or more precisely the http://en.wikipedia.org/wiki/Newtons_law_of_universal_gravitation - law of universal gravitation , is much much more than just apples falling to the earth. Really, do you think that Newton's reputation is based on such trivial observations? Prior to Newton, it was assumed that gravity was a force that drew objects downward toward the earth. Newton's great insight was to realize that gravitation is a universal force that exists between any two objects. And there was no direct observational evidence for that beyond our own planet until we started flying spacecraft past other celestial bodies. Nonetheless, nobody seriously doubted that gravitation was indeed universal.
I'm always open to a critical analysis of any scientific theory, if you had any evidence to support an alternate theory. But you'll have to do better than rejecting the scientific consensus just because the evidence doesn't meet your totally unrealistic and anti-scientific standard of "direct observation". ------------- Addeenul �Aql � Religion is intellect. |
Posted By: airmano
Date Posted: 19 April 2015 at 2:11pm
QE
Airmano |
Posted By: Tim the plumber
Date Posted: 20 April 2015 at 5:29am
It is a reasonable aproximation that the length of the day on Earth is 24 hours. Each day is slightly different, taking a day as noon to noon. The rotation of the Earth is not 100% stable. It is reasonable to expect that the rainfall in Sheffield, where I am, is going to be higher than the rainfall in Mecca this year. There may have been years where this was not true. But it's a fair bet. The rate of mutation is not fixed to the same degree as the rotation of the Earth but the rate is knowable to a higher degree than the variability of weather in Sheffield. Despite this I can confidently predict the overall climate for Sheffield within a reasonable range. There will be exceptions. The world is complex. Unlucky, deal with it. |
Posted By: Quranexplorer
Date Posted: 25 April 2015 at 3:41am
Both the approximations you mentioned above, the length of the day and the rainfall, become reasonable because 1) you have evidence that both these happen 2) you have real measurement data for both which you can refer and say this is how things have happened in the past and this is how things may play out in future--still it's only a prediction and nobody can be sure about it. Now in what way do you think the rate of mutation causing species change as assumed under TE becomes a reasonable assumption in comparison to your 2 examples above? |
Posted By: Tim the plumber
Date Posted: 26 April 2015 at 12:32pm
We can measure the rate of mutation per generation. This is easiest to do in a species which reproduces quickly like a bacteria but the data we have for humans is large rather than long and this can also be used. The thing with the rate of mutation and the impact of it on the theory of evolution is that it is nearly unimportant just how quickly a species throws out new mutations in terms of the pressure of the environment causing the selection of the most suited to survive. In normal conditions, all mutations are bad. The lion in Africa is already optimised to be the best lion. It's when conditions change that mutations can become advantagous. The lion in India has become silent and does not roar as a result of the hunting of man who has killed the niosiest and least shy lions. This process has happened at the rate determined by the rate of selection for this quietness and the rate of mutation amongst other factors. The rate of mutation may well be capable of doing it a lot faster than it has happened but the process took longer due to lots of events mostly involving human reasons. For a better, more direct, more simple and obvious time referance the fossil record is the best guide as to the history of the natural world. |
Posted By: Matt Browne
Date Posted: 06 May 2015 at 6:54am
The theory of evolution can be disproved. But to this day no scientist managed to achieve this. Again and again evolution can explain what happened after life started. It can make predictions about the future, which we can verify and we do. Comparative genomics, as Ron pointed out, confirms everything Darwin wrote during a time when no one had a clue about the DNA molecule and the universal letters of life. Isn't this truly beautiful? GGGAGTTTTCTCAGAAACATCATTCCCCCCACCCCAGCCATCATCCGTCTGCTCCGGAACCCGGCTCTGAGAGAGTGAGAGGATTTGAGATAAAGAGGCCGGCTGTGGCCTTGGTGAGCAACTTGCTACTCCTTCCTTTATTTTGTTCTGTTTAATTTGACTTGTTCAAACATGCCGCTGGGCATCTTTGTTCGGCGTATTATTATTACTCCCTTCGGAGTATAGACAGTGAAATATGGGGTATTTACAGACATCTTACTCCCTCCGTTCCATAATATAAGAGATTTTAAATAGATATGATATATTTTTGAATAATAAATCTGGATAGATGATATGTCAAATTCACTGTATTAGGATGTATCATATCCACCTAAAATCTCTTATATTATGGAACGAAGGGAGGATGTTCTTTTTCATAGTGTCCCCATGGTTATCATGGGATGTCTTTTCCTGCTAAGGCATCGTGTGCACACGATGCGTAGAGGAAAACACATGATGCAGATTCAGCTTAGAGAACAGAAAAATAAAATTATATGCCCTCTGACAGAAATGAAAATCAACAAATACTACAAGACTTTACAACAGCGCTGATATAACATGCTACTACTACTAGTACAACAGGAAAAAAATAATTCATGTAGCCTTCTAGCGGGTTCTATTTCCTTACTACATCTTTCTATTTCCTTTTTCCGTGAGGATCATAGTATCAACATTGAAATT ------------- A religion that's intolerant of other religions can't be the world's best religion --Abdel Samad Great minds discuss ideas. Average minds discuss events. Small minds discuss people--Eleanor Roosevelt |
Posted By: Quranexplorer
Date Posted: 09 May 2015 at 11:53am
Apologies for the delay. Got tied up with other important matters..
DNA evidence is not considered conclusive even beyond the first level of blood relations to establish human genetic lineage, and the accuracy diminishes with each level upwards. So how can something which cannot conclusively establish lineage within the species itself be a �clear proof� for the assumption of species changes through evolution? And by the way your TMRCA doesn�t qualify as independent evidence as the model runs based on the assumptions under the very Theory of Evolution.
If a theory by its very nature is incapable of being established through evidence, then it does not mean that everyone should accept it as fact.
I have no problems with theoretical concepts. All I am saying is these theoretical concepts are not substantiated by any evidence. Obviously there is a barrier separating each species in the contemporary world that they remain distinct always�now to suggest that time has the power to break such barriers doesn�t make sense unless you have some compelling evidence to substantiate such a claim�this is where evolution as a theory fails miserably.
TE as a theory can say there is no barrier--but the problem is you see a barrier in contemporary species and there is no credible evidence that the barrier was broken any time in the past. The eohippus to horse evolution is completely arbitrary with many errors. First, there is no way one can say for sure that different species represents links in a continuous chain of evolution�these are simply independent animals. Second, even the proposed chain leaves many contradictions like the proposed links appearing as contemporaries or even the upstream link appearing in more recent fossils compared to the downstream link.
I think each theory should stand on its own merits. If stellar evolution has got evidence and that can stand critical analysis, then maybe it can stand the test of time. But that doesn�t mean that one should accept evolution as a fact with no evidence.
I don�t understand what you mean by there was no observational evidence behind the theory of gravitation. It was Newton�s great insight that the force that caused an apple to fall down and the force that kept the moon in its orbit was the same. Thus the thought process behind the theory of gravitation itself was triggered as a natural outcome of an effort to explain some observed phenomena in the nature and then he could develop his thought process in to more concrete form through his laws which again could be tried and tested over and over again to make his theory in to a credible one. Even so, a theory of such stature was not spared from a critical analysis that Einstein came up with a serious modification to that theory. But when it comes to the Theory of Evolution, it did not come as a natural outcome to explain some observed phenomena in the nature; rather it just came out as a theory wherein even Darwin was ready to acknowledge the fact that finding such large quantities of transitional fossils will be one of the biggest tasks to substantiate his theory�which unfortunately has never happened. So basically in TE we have a theory that came in as a speculation, without any definite observed natural phenomena to explain, with the optimism that it can garner some evidence in its support in future�but that optimism has not come true so far.
My rejection of the theory of evolution is based on the absence of any evidence to substantiate its claims: 1. No large numbers of transitional fossils as expected 2. No observational evidence 3. No experimental evidence 4. No laws to support the theory 5. DNA evidence cannot establish genetic lineage with certainty even within a species itself beyond the first level of blood relations. 6. TMRCA does not provide an independent proof as the model is based on the assumptions under the very theory of evolution As I already mentioned, if a theory by its very nature is incapable of being established through evidence, then it does not mean that everyone should accept it as fact. But it�s absolutely your choice to consider a theory with no proof as fact with a reason that you don�t see (or maybe want to see) anything more reasonable to believe. |
Posted By: airmano
Date Posted: 20 May 2015 at 8:56am
1) How do you know ? Do you have a (mathematical) model predicting the number of expected transitional fossils showing a conflict with observation ? ---------------------------------------------------- 2) Sure there is, genetic as mentioned; morphologic (doesn't look a Chimpanzee skeleton similar to a human one ?) Not enough ? Go onto the http://www.sciencemag.org/ - "Science" website and type "Evolution". I got 37911 entries. Start to read ! ---------------------------------------------------- 3) I gave you the Lensky link already. The spread in the variety of domestic animals over a short time is another "experimental fact" ---------------------------------------- 4) Besides the law of natural selection... -------------------------------------------- 5) Genes get reshuffled upon sexual reproduction, so no surprise. If you throw 5 dices 5 times it is also difficult to calculate back which combination you had at the second trial. But: Mitochondrial DNA allows for a clear female lineage and the http://en.wikipedia.org/wiki/Y-chromosomal_Adam - Y-Chromosme for a clear male linage. Where is the problem ? ------------------------------------------------------ 6) Don't know, Picasso's paintings also don't provide any proof. But I think there is already enough proof anyway. Airmano |
Posted By: Ron Webb
Date Posted: 21 May 2015 at 8:08am
Yeah, and then I lost track of this discussion. (Thanks to airmano for bumping it.) I rely on the Active Topics feature to show me unread responses, but either I don't understand it or it doesn't always work reliably.
You'll have to show me where you're getting your information. There have been plenty of prominent examples of DNA establishing ancestry beyond the first level. The discovery of Richard III's body was confirmed mainly by DNA matches to two living relatives 18 and 20 generations distant, and http://www.le.ac.uk/richardiii/science/resultsofdna.html - according to the researchers , "Even at it�s most conservative, the probability of Skeleton 1 being Richard III is 99.999%." The remains of the family of Tsar Nicholas II of Russia were similarly identified, with DNA providing http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0004838 - "virtually irrefutable evidence" from relatives as many as four of five generations apart.
TMRCA ("time to most recent ancestor") is not evidence of anything. http://www.islamicity.com/forum/forum_posts.asp?TID=33189&PID=196071#196071 - You asked for a "universal law which links 2 different DNAs as a function of the assumptions made under the theory of evolution." So I gave you one. Yes, it's based on the theory -- just like you wanted.
There is abundant evidence, but you were asking for "direct observational evidence". It's your distinction, not mine, so I wish you would pay attention to it. It's getting kinda tedious the way you jump back and forth between the two.
You claim that contemporary species "remain distinct", and of course they will in future because they cannot interbreed. But have they always remained distinct, even in the distant past? Or were they once a single species that diverged over time? It's a different question, not dependent on interbreeding. The problem is that you're talking about two different definitions of "species". The defining characteristic distinguishing contemporary species (the "barrier", if you will) is that they are incapable of interbreeding; but the question of interbreeding doesn't even make sense when considering two species separated by millions of years.
There is no reason to suppose that the "links" have to disappear when the divergent species appear. They could continue to exist, and even evolve, for millions of years.
Again, if you're going to distinguish "direct observational evidence" from evidence in general, then please do so consistently. No one has continuously observed the entire process of stellar evolution, just as no one has continuously observed biological evolution over millions of years. My point was that your demand for "direct observational evidence", as opposed to just plain old evidence, is unreasonable and not required in many other scientific disciplines.
But he had no way of directly observing this force, except as it applied to the single special case of objects being mysteriously drawn toward a point at the center of the earth. He couldn't weigh the earth, or test the moon's gravitational field, or see what would happen to its orbit if the earth suddenly disappeared. It was hundreds of years before we could do any sort of extraterrestrial experimentation; but the theory of gravity was already well accepted.
Seriously? Darwin made no observations of nature? You really ought to read his book " http://darwin-online.org.uk/content/frameset?itemID=F373&viewtype=side&pageseq=1 - On the Origin of Species ", which begins as follows: "When on board H.M.S. 'Beagle,' as naturalist, I was much struck with certain facts in the distribution of the inhabitants of South America, and in the geological relations of the present to the past inhabitants of that continent. These facts seemed to me to throw some light on the origin of species�that mystery of mysteries, as it has been called by one of our greatest philosophers."
Yeah, never happened. http://en.wikipedia.org/wiki/List_of_transitional_fossils - Oh wait... ------------- Addeenul �Aql � Religion is intellect. |
Posted By: airmano
Date Posted: 30 June 2015 at 9:58am
|
You think the theory of Evolution is just a fairy tail ?
https://www.sciencenews.org/article/genetic-tweak-turned-plague-bacterium-deadly - Think again ! Airmano ------------- The word God is for me nothing more than the expression and product of human weaknesses (Albert Einstein 1954, in his "Gods Letter") |
Posted By: lindseynicole
Date Posted: 03 July 2015 at 1:11am
|
This is true that DNA test is done for identify the parental relationship with the particular person because without it identification of relation is not possible. |
Posted By: airmano
Date Posted: 17 July 2015 at 1:43am
|
For those that are still in doubt:
Here comes another good article: http://www.scientificamerican.com/article/15-answers-to-creationist/ - Evolution Airmano ------------- The word God is for me nothing more than the expression and product of human weaknesses (Albert Einstein 1954, in his "Gods Letter") |
Posted By: Tim the plumber
Date Posted: 18 July 2015 at 2:41am
If you get a DNA sample from a crime scene it is often possible to say that it was not the suspect but it was his brother for instance. It may be that they say it was his brother from the same mother or from the same fater or both. The DNA will show this. Such science has been used to track the way human populations have moved about over the centuries. |
Posted By: Quranexplorer
Date Posted: 11 September 2015 at 1:37pm
Let me try to pick this from where it was left:
It should not be rocket science that with your ancestors growing in a geometric progression, the accuracy of establishing a precise genetic match at an individual level comes down as there are more contributors who could have passed a specific genetic material to you. And the hilarious part is that within a few thousand years you end up with more ancestors than you have sections of the DNA, meaning you have ancestors who have passed you some genetic material and who have not. If that doesn�t help, here is the scientific sense from experts in the field of genetics itself why http://www.senseaboutscience.org/pages/genetic-ancestry-testing.html - Genetic Ancestry Testing is nothing more than Genetic Astrology You need to read those specific cases in detail, the genetic evidence here is nothing but based on a probabilistic and statistical genetic testing model based on the hypothesis that all the circumstantial evidences presented are correct and the individuals tested are genetically related. So the genetic testing does not have any meaning as independent evidence as clearly stated in the link above.
TMRCA is not a law of science. "A scientific law is a statement based on repeated experimental observations that describes some aspects of the universe. A scientific law always applies under the same conditions, and implies that there is a causal relationship involving its elements." (just google for this definition) There are no experimental observations for TMRCA, but only a theory. There is not even a universal statement to qualify TMRCA as a law.
Of course it becomes tedious when you are asked to present something you clearly don�t have. The bottom line is apart from not having the experimental or observational evidence to support a theory, Theory of Evolution clearly fails to present any sort of credible evidence to support the kind of claims that it makes.
As I have made it clear, I have no problems with theoretical claims. All I am saying is you have no evidence to support the claim that two distinct species as we see today are just separated by millions of years of evolution. The fossil evidence is clearly not there and as I mentioned above the DNA analysis cannot provide accurate information even about an individual�s ancestry beyond the first level.
No problems with theoretical concepts. The problem starts when people start projecting these as facts with no credible evidence.
"Scientific evidence is evidence which serves to either support or counter a scientific theory or hypothesis. Such evidence is expected to be empirical evidence and interpretation in accordance with scientific method." (Just google for this definition) Now to make it more clear here is the meaning for �empirical�: empirical ɛmˈpɪrɪk(ə)l,ɪm-/ adjective 1. based on, concerned with, or verifiable by observation or experience rather than theory or pure logic. Now please present some evidence that meets the above criteria. As you admit, there is clearly no observational or experimental evidence for TE. Moreover, the fossil evidence is clearly not there and as I mentioned above the DNA analysis cannot provide accurate information even about an individual�s ancestry beyond the first level. So what is the evidence that you are talking about?
I don�t know how many times I have to repeat that Gravity clearly had the empirical evidence through Galileo�s experiment and the support of Newton�s laws of motion which again anybody can subject to experimental observation and see its effectiveness for themselves. But no such thing for TE.
Darwin�s observations are no way comparable to the theoretical concepts that he has presented in his Theory of Evolution. He or for the matter no one could have made some observations to the tune of things hypothesized in TE simply because TE assumes such changes happen in millions of years.
That sounds great! Out of roughly 8.7Million species in existence today, you got 24 transitional fossils (that is a great 0.0003%!), and that too not even one of those 24 presents a complete link showing the transition from one species to another.
|
Posted By: Tim the plumber
Date Posted: 19 September 2015 at 4:55pm
|
QE; Is your position that DNA testing does not work? It is easy to test; Take a sample from your grandfather, label it 1. Take a sample from your mother, label it 2. Take a sample from your distant cousin, label it 3. Take a sample from yourself, label it 4. Take a sample from a dog, label it 5. Send the samples off for testing, asking the lab to identify the relationships between the samples. If they get it right your position is wrong. Only if they get it right. The chance of them doing this by chance is practically nill. If they cannot get it right then you will have demonstrated that DNA testing dose not work. You will be a hero in the religious world. I bet you don't do it. I know why you will not do it. So do you. |
Posted By: airmano
Date Posted: 20 September 2015 at 10:40am
|
We have no evolutionary evidence ?
How come that renowned scientists have now drawn a first draft of http://www.pnas.org/content/early/2015/09/16/1423041112.full.pdf - the tree of life Strange: Airmano ------------- The word God is for me nothing more than the expression and product of human weaknesses (Albert Einstein 1954, in his "Gods Letter") |
Posted By: Quranexplorer
Date Posted: 27 September 2015 at 12:12am
|
TTP, looks like you missed the point completely. The point is DNA analysis doesn't prove evolution, or for that matter, nothing does.
Now tell me how the below example proves evolution? Are you saying you can establish genetic ancestry at say the 100th level of the chain accurately? If you can prove that then you would be good enough as well to teach all those professors who don't think so. |
Posted By: Quranexplorer
Date Posted: 27 September 2015 at 12:22am
|
Airmano, do you really understand the difference between a theoretical model and scientific evidence?
How can a theoretical model based on the theory can be the scientific evidence for that very theory? |
Posted By: Tim the plumber
Date Posted: 29 September 2015 at 1:12am
DNA does prove evolution. By understanding the way DNA transmitts information to the next generation you can understand the ancestry of the person/animal/plant/fungus whatever. That you cannot say precisley which particular individuals were an ancester at 100 generations back does not change the fact that you can be certain that it was him or somebody closely related to him. Thus King Richard of York's body was identified with a very high level of certainty, not quite 100% but very close. The destinctive hunch back, huge frame, battle damage and location providing the rest of the evidence. For species where the difference you are looking for is greater it is much easier to do this. Thus it is understood how many (ish) generations there have been between dolphins and killer whales being one interbreeding population. The reson this proves evolution, and here I use prove in the sense that it proves well beyond the level of proof of a legal case but less than a maths proof, is that evolution was written before the mechanism was know. Evolutionary theory predicted that there would be a mechanism and that it would work in a way that resulted in results that evolutionary theory predicted. It does. |
Posted By: Tim the plumber
Date Posted: 29 September 2015 at 1:22am
It never is. The evidence that the theory is right is that it makes profound predictions that are correct. That these predictions can be tested and can be failed. The more that it is expected that the prediction will fail but does not the more profound and strong the theory. example; In 1687 (thanks google) Newton, the most profound scientist ever, published Principia Mathematica. It was almost unreadable but did have the relationship between force mass and acceleration in it. That is the basis of physics. From it it is possable to predict the fall of an object. This was so shockingly radical that people made livings going around and doing shows where they would have lead balls rolling down slopes above a drop and use maths to predict the point that they would land on on the floor. People were not used to the very idea that the world was predictable in this way. Obviusly the artillery officers of the day were impressed by this and made use of it. The guys doing the stage shows soon found that they made a lot more money advising on other stuff and the consultant engineer was born. |
Posted By: airmano
Date Posted: 29 September 2015 at 1:36am
|
@QE:
What makes you say that the tree of life I linked above is a "theoretical" model ? Airmano ------------- The word God is for me nothing more than the expression and product of human weaknesses (Albert Einstein 1954, in his "Gods Letter") |
Posted By: Quranexplorer
Date Posted: 01 October 2015 at 6:57am
|
Airmano,
So do you have some empirical evidence to suggest it is anything more than a theoretical model? |
Posted By: Quranexplorer
Date Posted: 01 October 2015 at 7:15am
Exactly! It is that ability of Newton's theory to withstand such empirical tests showing the physical results always match with his theoretical predictions that sets it apart as a strong theory. Unfortunately, theory of evolution has no such empirical evidence. Don't you ever think why you have to always take the help of Newton's theory to explain what a good theory is like? Why not try explaining with TE? |
Posted By: Quranexplorer
Date Posted: 03 October 2015 at 5:07am
DNA does not prove evolution. Let me explain you: There are 2 aspects here: 1) The accuracy of DNA predictions and 2) Testing of DNA based evolution predictions. 1) The accuracy of DNA predictions: What you do in a DNA analysis is you make a prediction on one's ancestry by matching the genetic components and you see that the prediction matches almost 100% with the fact if you are testing two individuals in a first level connection in the chain. But the accuracy comes down with each level upwards and at some point you see that you end up with more ancestors than you have sections of the DNA which means the only way you can make a prediction is by way of a guesstimate.
2) Testing of DNA based evolution predictions: You have already seen that DNA analysis itself is a guesstimate beyond the first level. Now what you do in a DNA based evolution prediction is you form a theoretical model based on ET adding more guesstimated variables including the mutation rate and then come to a super guesstimated figure which you call the TMRCA. So ultimately what you have in a DNA based evolution prediction is all guesstimates upon guesstimates with absolutely no empirical evidence. Now how can one with some minimum level of understanding even think in his wildest dreams that DNA proves evolution? I am getting more and more convinced that it is really a matter of choice what people like to believe. Otherwise how can someone who relies on his reason as the only way to find truth come up with such made-up stories of �DNA Analysis Proves Evolution� when the facts and normal human reason clearly proves �DNA Analysis Does Not Prove Evolution"? |
Posted By: airmano
Date Posted: 03 October 2015 at 9:07am
Obviously you try to avoid answering my question with the rhetorical trick of asking a counter-question. That much for the argument... To answer it nevertheless: The model is based exactly on the empirical evidence you claim to be non-existent. Did you actually have a look at it ? ----------------------------------------------------- Sorry QE, once more: your claim "there is no evidence (for ET)" is getting kind of tiring. Just type "empirical evidence Evolution theory" in Google (do you know how to do this ?) and you find on the first page: http://anthro.palomar.edu/evolve/evolve_3.htm - Evidence and even a https://en.wikipedia.org/wiki/Objections_to_evolution - Wiki entry on this subject. I'm sure that you're only looking for info comforting your point of view and all the rest is blinded out. Not good: Airmano ------------- The word God is for me nothing more than the expression and product of human weaknesses (Albert Einstein 1954, in his "Gods Letter") |
Posted By: Tim the plumber
Date Posted: 04 October 2015 at 12:03pm
No you are misunderstanding the way in which DNA shows which species have common ancestors. In a protein the big molecule has a small active bit which does the work and a load of scaffolding which supports the working bit. This scaffoulding is arranged by the cell using the DNA to tell it how to do it just as is the active bit of the protein. The active bit of the molecule is forced, generally, to not change because any mutation in it will cause it to not work. The rest, the "junk DNA", can have mutations and this will not, generally, effect the functioning of the cell and thus the survival of the creature. If the way the DNA for an enzine which is in an oak tree is the same in it's active bit as in an apple tree but the scaffolding is slightly altered it is reasonable to see that they have a common ancestor. This one piece of evidence is not at all strong. It takes a few hundred before absolute certainty is reached. The DNA of these trees has millions of such similarities which are the result of them evolving from the same species of tree. Why are you so hung up on evolution? It is surely geology and geography which show the age of the world. Astronomy shows the age of the universe. These are the sceinces which show that the Bible is wrong in it's story of creation. I take it the Koran is similar? |
Posted By: Ron Webb
Date Posted: 04 October 2015 at 4:37pm
Yeah, I'd forgotten all about this discussion.
You're absolutely right -- when we go back millions of years, the accuracy at an individual level comes down. But we're not trying to match individuals back that far. We're matching species. It's rather like arguing that radar is fine for measuring the distance of individual geese at close range, but it can't distinguish individuals in a flock of geese at great distance. So what? It can still measure the distance to the flock.
No, the genetic information is independent of any circumstantial evidence. As for the link, it talks exclusively about individual genetic testing, not species comparisons. Good grief, several of the experts quoted in your source are specialists in evolutionary genetics! Surely you don't think they meant to imply that the whole basis of their field of study is flawed?
Whether you call it a law or not is a matter of semantics, but it is an empirical method (several of them actually) which links two different DNAs with an estimate of their evolutionary distance. http://www.islamicity.com/forum/forum_posts.asp?TID=33189&PID=196071#196071 - That's what you asked for .
Of course there are experimental observations. How do you think they calibrated the models? "Estimates of TMRCA are thus based on the observed number of mutations by which the two Y chromosomes differ." http://nitro.biosci.arizona.edu/ftdna/quick.html - http://nitro.biosci.arizona.edu/ftdna/quick.html
(Why didn't you just say https://en.wikipedia.org/wiki/Scientific_evidence - Wikipedia ?)
I said there is no direct observational evidence. Nobody has directly observed the evolution of a new species, simply because the process takes millions of years. However, there is plenty of indirect observational empirical evidence, i.e. DNA evidence. By the way, I find it very odd that the people who demand direct observational evidence of evolution never think to apply the same standard to creationism.
------------- Addeenul �Aql � Religion is intellect. |
Posted By: Ron Webb
Date Posted: 04 October 2015 at 5:32pm
That's why it becomes more difficult to identify specific ancestors the farther back you go; but that's not what we're trying to do. We're trying to show that two contemporary individuals had a common ancestor (never mind who); and for that, the problem is almost the opposite. The farther back you go, the more likely it is a priori that any two random individuals will have a common ancestor. In fact, according to your source, if you go back a mere 3500 years it's not just a guesstimate, but a virtual certainty that they do, even without doing the genetic testing. (That number sounds surprisingly low, by the way. I'm looking into where they got it.) That's why they are criticizing commercial services that offer individual genetic ancestry testing. It's not that they are necessarily wrong. In fact, for many predictions they are almost certainly right. If you are of Nordic stock, then you probably had a Viking in your ancestry. If you are European, there was probably a Roman soldier back there somewhere. But you didn't need a DNA test to tell you that. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Quranexplorer
Date Posted: 09 October 2015 at 4:59am
Good. So we are clear that DNA analysis is not accurate beyond the first level. So there is no way you can test the evolutionary hypothesis using DNA analysis as DNA analysis fails as an empirical method to establish a scientific evidence beyond the 1st level. So how can you say "DNA analysis proves evolution" when you agree that it fails as an empirical method beyond the first level? |
Posted By: Quranexplorer
Date Posted: 10 October 2015 at 3:04am
If you are talking about DNA analysis, it is not accurate beyond the first level and cannot be used to test a theoretical model to establish an empirical evidence. -----------------------------------------------------
Even I find it tiring when people keep repeating the same so called "evidences" when it is clear that none of these so called "evidences" can "prove" evolution. Nevertheless, In Sha Allah I won't give up helping those weaker in understanding to understand the truth as far as I can do. Let's have a look at the so called "evidences" presented in your link: 1. Fossil Record: There is not even one fossil record that completely shows all the links to support evolution of one species to another. Even this incomplete record is so minuscule that there are only 24 or so of the so called transitional fossil records against a few millions of species identified so far. http://www.nytimes.com/1989/12/15/opinion/l-theory-of-evolution-has-never-been-proved-151289.html - Even with more than 100,000 species represented in fossils, the lack of intermediate forms is even greater than it was in Darwin's day . So the fossil record clearly fails to support the Theory of Evolution. 2. DNA Evidence: As we have already seen, DNA analysis is not accurate beyond the first level and cannot be used to test a theoretical model to establish an empirical evidence. 3. Geographic Distribution of Related Species: What is the scientific evidence to the author's speculation that evolution is "The most likely explanation"? 4. Genetic Changes over Generations: How can the genetic changes within a species be blindly extrapolated to claim species changes without any empirical evidence for the same? |
Posted By: Ron Webb
Date Posted: 10 October 2015 at 7:18am
That's like saying you can't see individual atoms from a distance of several miles, so there's no way we can determine the location of a star using light. At a distance of hundreds of generations, DNA analysis is not http://www.diffen.com/difference/Accuracy_vs_Precision - precise enough for identifying individuals, but it's still accurate, and it can still identify family relationships at larger scales. The problem with individuals is that if you go back far enough, every human is related to every other human, so the question of whether two individuals belong to the same family becomes meaningless. If you look back far enough, we all shared a common ancestor at some point, so we're all ultimately in the same family -- the human family. DNA confirms that. If that were not true, it would be meaningless to refer to "human DNA". And in exactly the same way, we have simian DNA, confirming that we belong to the simian family along with the apes. We also have mammalian DNA, which places us in the mammalian family, and so on. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Quranexplorer
Date Posted: 10 October 2015 at 8:40am
At distances of hundreds of generations it is not even a question of accuracy. At distances where your ancestors growing in a geometric progression exceeds your DNA components, you simply cannot have an empirical match using DNA.How can you say an empirical method that has a reducing accuracy with distance and simply fails at some point at an individual level becomes more accurate when applied at a larger scale? It should be the other way around simply because of the fact that you will have to have more approximations to apply a variable that necessarily remains at an individual level to be representative of a larger population.
You are getting closer. And that is perfectly in line with what you observe--human species always remain human species. And it is perfectly in line with the idea of all humans created from a single soul: Quran 4:1 "O mankind! Be careful of your duty to your Lord Who created you from a single soul and from it created its mate and from them twain hath spread abroad a multitude of men and women. Be careful of your duty toward Allah in Whom ye claim (your rights) of one another, and toward the wombs (that bare you). Lo! Allah hath been a watcher over you."
Now what you are saying is the theoretical part and something not substantiated either by observation or by any other credible empirical evidence to be accepted as a fact by the existing scientific standards. |
Posted By: Quranexplorer
Date Posted: 10 October 2015 at 9:12am
You say �If the way the DNA for an enzine which is in an oak tree is the same in it's active bit as in an apple tree but the scaffolding is slightly altered it is reasonable to see that they have a common ancestor�. But the expert scientists in the field of genetics say DNA is a complex subject and it is not reasonable to make such casual assumptions. Moreover, as the DNA analysis cannot give you an accurate result beyond the first level, it cannot be used to test your assumption to establish an empirical evidence. Basically you have an assumption that is not reasonable at first place and one that cannot be tested empirically as well.
They say science is the search for truth and as I have made it clear many times earlier, I have no problems with science as long as it is being used for that purpose. There is a problem when people start using science for their own vested interests. I too wonder over the question why people are in such a hurry to project the Theory of Evolution as scientifically �proved� when the hypothesis does not have even one successful empirical test to its credit. Whilst established theories like Newton�s Theory of Gravity were always open to further evaluations to be modified by Einstein at a later stage in spite of having such solid backing of repeated empirical evidences to its credit. People seems to be so emotionally attached to TE that they are ready to blindly accept it as a fact without even giving a thought whether it has got some scientific evidence to back it. The only reason I think that can explain this strange behaviour is the human nature to defiantly justify its choice irrespective of reason. Once you have made a choice to deny the creator, anything that supports that choice seems to be fine irrespective of reason. As to the Quran, I have been asking in this forum to prove a wrong statement in Quran conclusively and definitively, but none so far! |
Posted By: Quranexplorer
Date Posted: 10 October 2015 at 11:57am
To quote from the same link: �There are millions of possible �stories� of your ancestry. To know whether any one of them is likely to be true, it would need to be tested statistically for its likelihood against other possibilities.� Now if you read your King Richard link, this is precisely what they have done�using the circumstantial evidences to statistically test their genetic test results to come to a conclusion. Those individuals being experts from the field of genetics doesn�t mean that they should blindly come to a conclusion that �DNA Analysis proves evolution� in the absence of any credible empirical evidence. For that matter I wonder if you would be able to find even one scientist of credibility who would dare to make such a conclusive and definitive statement like �Theory of Evolution has been proved scientifically�.
The one thing that I like about science is it has got some established framework to work with and is not something that works on individual whims and fancies. So a scientific law has to be a scientific law and TMRCA fails to qualify as one: �A scientific law is a statement based on repeated experimental observations that describes some aspects of the universe. A scientific law always applies under the same conditions, and implies that there is a causal relationship involving its elements." (just google for this definition) There are no experimental observations for TMRCA, but only a theory. There is not even a universal statement to qualify TMRCA as a law.
Maybe you missed this part from the same write-up: �Since mutations occur at random, the estimate of a TMRCA is not an exact number (i.e., 7 generations), but rather a probability distribution, a function that gives the probability that the TMRCA is a certain number of generations or less (i.e., a 47% probability that the TMRCA is 16 generations or less)�. I wonder how can you have even a fair estimate of �Random Mutation� which necessarily doesn�t follow any set patterns?
No so called indirect observational empirical evidence is enough to �prove� the theory. The so called indirect observational evidences including the DNA evidence are nothing more than theoretical models based on geusstimates and fail to qualify as empirical methods to independently test and prove ET.
My endorsement of the idea of an ultimate creator is based on a faith based belief. And it would be foolish to think that the creator who could create a universe that still remains beyond the capability of the best of human minds to explain has to be proved by an imperfect tool called science created by his imperfect creations. I feel no problem in admitting that I am following a faith based belief and I rely on Allah�s guidance where my reason becomes incapable. I can�t be like some others who claim their reason as the only way of guidance and would still cling to their choice even when it is clearly against human reason to do so
|
Posted By: abuayisha
Date Posted: 11 October 2015 at 8:22am
Masha'Allah! How very true. |
Posted By: Ron Webb
Date Posted: 11 October 2015 at 9:09am
No, it's the opposite problem. It's not that you cannot get a match at distances of hundreds of generations. The problem is that you almost cannot fail to get a match, because practically everybody is related to everybody. For instance, DNA analysis might suggest that an individual may be a direct descendent of the Queen of Sheba; but then, the same test would also give high confidence that he or she is related to Sheba's sister and mother and second cousin twice removed, not to mention their servants and their hair stylists -- all of which is probably true, but so what?
I wasn't aware that DNA analysis can be applied to souls.
But it has been substantiated by countless observations. In every case where it is possible to directly observe a famiy relationship, the DNA predictions align nicely with actual observations. What you're saying is that because we can't directly observe populations over millions of years, therefore this otherwise well-substantiated theory no longer applies. I'm sorry, but I think you need to make that case. Why wouldn't it apply? Science does this all the time. Spectral analysis is a well-established methodology for determining chemical constituents of substances. We have countless observations here on earth confirming the technique. We also use the technique to find the chemical constituents of stars millions of light-years away, although we have no "direct observational evidence" to corroborate it at that distance, i.e. nobody has actually dipped a test tube in the stellar atmosphere and brought it back to a lab. But nobody seriously doubts the reliability of spectral analysis of stars.
You're conflating individual instances, which are random, with the overall rate of mutation, which is fairly constant. This is known as the https://en.wikipedia.org/wiki/Fallacy_of_composition - fallacy of composition .
Why not? No serious nuclear physicist doubts the existence of quarks or neutrinos, none of which have been directly observed. No geologist questions that the earth has an iron core, although that has never been directly observed. And I could go on. === P.S.:
In other words, if you start by assuming your conclusion, then you don't have to prove anything. ------------- Addeenul �Aql � Religion is intellect. |
Posted By: Quranexplorer
Date Posted: 16 October 2015 at 12:20am
It is simple logic that at an ancestry population that exceeds your DNA components you cannot have a one to one match using a DNA component simply because there could be some who could have passed a specific DNA component to you and some who have not. An empirical test that suggests all the alternatives as true is as good (or say bad) as an empirical test that cannot give any true result--which is exactly the case with DNA analysis when used to test TE. And that is precisely the reason the DNA evidence you claim for TE is at best still a guesstimate.
The reason I am saying TE has never been proved is because there is not a single empirical evidence that has tested the entire scope of TE which in very simple terms theorizes the millions of different species that are in existence today as a result of some basic life form(s) (and don't ask where this basic life form(s) came from!) undergoing the process of evolution. All the evidences that you claim are simple extrapolations of a partial observation without any scientific base for such extrapolation. It is possible to establish an empirical evidence for a family relationship within a species to a limited length using DNA, but this fails at increased lengths within the species itself and there is no scientific base to extrapolate this DNA relations to support a species change. Contrary to the DNA analysis for TE, we can clearly see that spectral analysis as an empirical method is able to test the full scope of what is to be tested--it can determine the chemical constituents fully and there is no need for further guesstimates or extrapolations to match its results with what is observed. It is this ability of spectral analysis to produce consistent true test results for the entire scope of its test subject that gives people confidence on this method. But DNA analysis at first place have not tested the entire scope of TE even in one case, and as an empirical method cannot even produce consistent test results even within a species, which only forms a partial scope of what TE covers.
Still that's a guesstimate. I really don't understand your concept of a variable at an individual level that necessarily remains random, how on earth that can become a non guesstimate when combined at a population level? The fallacy of composition talks about the fallacy in assuming something true at a whole level to be true for each part. Here you have no idea what you assume at the whole level is true in first place, and the whole is only a guesstimate derived by combining a number of individual guesstimates.
So are you saying people have just accepted these as facts without any empirical evidence, as you suggest to do with TE? As I have mentioned before, I think each theory should stand on its own merits. If people seriously doubts the empirical evidences for a theory then it should be open for discussions rather than just trying to jump to conclusions saying some thing has been "proved" when it is not proved scientifically.
Science can never disprove an ultimate creator. In spite of that you start by assuming there is no creator. There itself one makes a choice and goes against the "reason as the only way of guidance" argument.
Even if one chooses reason as the only way of guidance, he acknowledges the fact that there is no guarantee that his reason will guide him to the truth simply because the best of human minds have still been unsuccessful in reasoning out the universe, let alone the concept of a creator--and there is no reason to believe man will achieve this "perfect knowledge on everything" at some point in time. That is perfectly the reason why a "only reason" based proponent remains in a constant state of doubt. Whereas for a true believer, he's out of the state of doubt from the very moment he submits to the will of Allah. And once he approaches the Quran with true submission to Allah, any trace of doubt he may have regarding the ultimate creator also gets cleared. Now for him it's only a matter of how he can get closer to Allah each day, and that is by way of living a righteous life in this world. And as Allah asks in the beautiful Surah Ar-Rahman (55:60) "Is the reward of goodness aught save goodness?". So a true believer has nothing to loose, except the so called pleasures of this world, which if one understands truly, can only increase the turbulence in one's life as he gets more and more immersed in it. Even a simple risk assessment should help one make the right choice--would you deny a creator without any clear proof just because your pride doesn't allow you to accept a creator whose wisdom exceeds yours, in spite of the terrible consequences one will have to face for such willful misconduct, OR would you prefer to submit to the will of an ultimate creator whose words are there to guide you, and all what you have to do is to live a righteous life with a promise of a reward that far exceeds your righteous deeds? So ultimately it boils down to the choice each one makes about his life and time is of the essence for this whole thing. Choose wisely and time will tell who is a better believer. |
Posted By: Tim the plumber
Date Posted: 16 October 2015 at 2:08am
|
QE, The point of the DNA result which states that you will be related to Mohamed at some distance because pratcially all people in the middle east are so related somehow is still able to say that you are not decended from Aborigonal Austrailian stock. Just because the answer is not a simple one does not make it wrong. |
Posted By: Ron Webb
Date Posted: 16 October 2015 at 8:54am
Agreed, but we're not trying to do a one-to-one match. We're matching populations. Yes, there could have been a particular individual's DNA introduced at some point in the genetic history of another individual, which has left no genetic markers. But that doesn't matter. We're analysing the markers that are there; and those markers show common ancestry with chimps etc.
If you're trying to pinpoint a specific individual ancestor, yes. If you're simply asking how long ago two living persons shared a common ancestor, then the test works the same whether it's one generation ago or a thousand. The fact that the answer is always true in the latter case simply means that all humans share common ancestors if you go back far enough -- no surprise there. The surprise is that going back hundreds of thousands of generations, we discover that we also share common ancestry with other apes.
The entire scope?? You mean you won't be convinced until we've DNA-sequenced every single species on earth? That could take a while... 
We are not able to confirm that spectral analysis works over millions of light-years distance, any more than we are able to confirm that DNA analysis works over millions of generations of time. But of course there is no reason to suppose that it wouldn't, in either case. If you want to argue that the extrapolation is unreliable, you need to come up with a theory to explain why it might be unreliable. And you can't argue that it is unreliable because we can't distinguish individuals at a distance of millions of generations. That's like saying spectral analysis is unreliable if we can't distinguish individual molecules at great distances. We're not trying to do that.
We can't precisely know the kinetic energy of a single molecule in a cloud of gas (if only because of https://en.wikipedia.org/wiki/Uncertainty_principle - Heisenberg's uncertainty principle ). However, we can measure very precisely the average kinetic energy of the entire cloud. We call that the "temperature" of the gas.
I'm saying no one has ever directly observed a neutrino, or the earth's core. We have plenty of empirical evidence of other kinds.
I am assuming no Creator, unless/until someone can provide evidence of His existence. In the same way that I assume the non-existence of Russell's Celestial Teapot, the Tooth Fairy, and Big Foot. Without applying Occam's Razor to such unsubstantiated claims, the world would very quickly become overcrowded with all sorts of bizarre imaginary entities which could neither be proven nor disproven.
There is also no guarantee that reason will guide you to the true God, or the true faith. Unfortunately, reason is all we have.
I suppose one could eliminate doubt by abandoning reason and adopting an arbitrary faith, but that is not the way to truth. Anyway, why do you want to be "out of the state of doubt"? Doubt is just another word for wonder. Why would you want the world to be less wonderful than it is?
It seems to me that most of the turbulence in the modern world is caused by "true believers" of one kind or another.
Gosh, why do theists keep harping on this "pride" thing? If anything, it seems to me that it is the "true believers" who are motivated by pride. I am content to admit that there are many things about the world that I just don't know. I don't pretend to have any mystical insights or superior knowledge that I can't prove. That would be false pride. As for http://en.wikipedia.org/wiki/Pascals_Wager - Pascal's Wager , it doesn't work for two reasons. First is the obvious one: I can't choose to believe something that just doesn't make sense to me, and pretending to have a belief that I don't actually have is not going to fool an omniscient God for a moment. If anything my hypocrisy might make Him even angrier. Besides, how do we know that God even wants us to believe in Him? It seems to me that if an omnipotent God truly wanted me to believe, He would have no difficulty convincing me of His existence. On the contrary, He seems to keep a remarkably low profile. Perhaps it's just the opposite. Perhaps He is like a researcher running a psychology experiment. It is important that the subjects of the experiment are not aware that their behaviour is being monitored and manipulated, because that awareness would distort the results. Maybe God wants to see who will do the right thing simply because it is the right thing, and not because of any imagined rewards or punishments in some afterlife. Maybe He will be angry with you because you are pretending to know Him and trying to tell others about Him. Maybe you are ruining His experiment. ------------- Addeenul �Aql � Religion is intellect. |